Important note

Mutalyzer 2 is no longer supported and access to it will be provided only for a limited amount of time.

Please switch to Mutalyzer 3 !

Variant Description Extractor

Please note that this is an experimental service and we are currently limiting input sequences to 15,000 bp.

Extract the HGVS variant description from a reference sequence and an observed sequence. For now, we require the user to fill in two sequences. After the testing phase, we plan to use the underlying algorithm for:

Disambiguation in the name checker. This will enable full support for complex variants.
Comparison of two reference sequences. Useful for migrating a variant description to an other reference sequence.
Implementation of a Reference Sequence Editor.

The algorithm is implemented in the HGVS variant description extractor. To apply it on longer input sequences than accepted on this page, you can download that package and run it locally.

Please supply a reference sequence and an observed sequence.

Reference input

Enter a sequence (FASTA, FASTQ, or plain text).

Upload a file (FASTA, FASTQ, or plain text).

Enter a RefSeq accession number.

Reference sequence

Example: ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA

Sample input

Enter a sequence (FASTA, FASTQ, or plain text).

Upload a file (FASTA, FASTQ, or plain text).

Enter a RefSeq accession number.

Sample sequence

Example: ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA

Help